circad | circRNAs associated with diseases

circVAPA
Gene	VAPA	Organism	Human
Genome Locus	chr18:9931806-9937063:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	30797148
Experimental Method
Sample Type	Tissue and cell lines	Comparison	A total of 60 matched pairs of CRC and adjacent normal mucosatissues were collected along with peripheral blood samples
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGGATTCCAAATTGAGATGCGTATT Reverse CACTTTTCTATCCGATGGATTTCGC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, XN, Wang, ZJ, Ye, CX, Zhao, BC, Huang, XX, Yang, L (2019). Circular RNA circVAPA is up-regulated and exerts oncogenic properties by sponging miR-101 in colorectal cancer. Biomed. Pharmacother., 112:108611.